'A'

'A'

'ACGT'

'ACGT'

st = 'ACGT'

len(st) # getting the length of a string

4

'' # empty string (epsilon)

''

len('')

0

import random
random.choice('ACGT') # generating a random nucleotide

'C'

random.choice('ACGT') # repeated invocations might yield different nucleotides

'C'

random.choice('ACGT') # repeated invocations might yield different nucleotides

'T'

random.choice('ACGT') # repeated invocations might yield different nucleotides

'A'

random.choice('ACGT') # repeated invocations might yield different nucleotides

'G'

# now I'll make a random nucleotide string by concatenating random nucleotides
st = ''.join([random.choice('ACGT') for _ in range(40)])
st

'GTCACATAATGCTGTAGATTAAGCGAGAAGACCTTAGGTC'

st[1:3] # substring, starting at position 1 and extending up to but not including position 3
# note that the first position is numbered 0

'TC'

st[0:3] # prefix of length 3

'GTC'

st[:3] # another way of getting the prefix of length 3

'GTC'

st[len(st)-3:len(st)] # suffix of length 3

'GTC'

st[-3:] # another way of getting the suffix of length 3

'GTC'

st1, st2 = 'CAT', 'ATAC'

st1

'CAT'

st2

'ATAC'

st1 + st2 # concatenation of 2 strings

'CATATAC'