!blastx \
-query /Volumes/web/scaphapoda/Grace/Transcriptomes/M_donacium_fasta.fa \
-db /Volumes/Data/blast_db/uniprot_sprot \
-max_target_seqs 1 \
-max_hsps 1 \
-outfmt 6 \
-num_threads 16 \
-out /Volumes/web/scaphapoda/Grace/mesodesma_blastx_uniprot_hummingbird.tab
Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 53 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 54 replaced by X Selenocysteine (U) at position 85 replaced by X Selenocysteine (U) at position 74 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 128 replaced by X Selenocysteine (U) at position 261 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 53 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 54 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 259 replaced by X Selenocysteine (U) at position 277 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 366 replaced by X Selenocysteine (U) at position 368 replaced by X Selenocysteine (U) at position 375 replaced by X Selenocysteine (U) at position 377 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 132 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 126 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 123 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 123 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 53 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 54 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 140 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 493 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 192 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 204 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 122 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 140 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 259 replaced by X Selenocysteine (U) at position 277 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 366 replaced by X Selenocysteine (U) at position 368 replaced by X Selenocysteine (U) at position 375 replaced by X Selenocysteine (U) at position 377 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 259 replaced by X Selenocysteine (U) at position 277 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 366 replaced by X Selenocysteine (U) at position 368 replaced by X Selenocysteine (U) at position 375 replaced by X Selenocysteine (U) at position 377 replaced by X Selenocysteine (U) at position 134 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 85 replaced by X Selenocysteine (U) at position 74 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 53 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 54 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 133 replaced by X Selenocysteine (U) at position 130 replaced by X Selenocysteine (U) at position 263 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 140 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 122 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 53 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 53 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 54 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 129 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 128 replaced by X Selenocysteine (U) at position 261 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 259 replaced by X Selenocysteine (U) at position 277 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 366 replaced by X Selenocysteine (U) at position 368 replaced by X Selenocysteine (U) at position 375 replaced by X Selenocysteine (U) at position 377 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 264 replaced by X Selenocysteine (U) at position 282 replaced by X Selenocysteine (U) at position 323 replaced by X Selenocysteine (U) at position 335 replaced by X Selenocysteine (U) at position 357 replaced by X Selenocysteine (U) at position 371 replaced by X Selenocysteine (U) at position 373 replaced by X Selenocysteine (U) at position 380 replaced by X Selenocysteine (U) at position 382 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 126 replaced by X Selenocysteine (U) at position 85 replaced by X Selenocysteine (U) at position 74 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 132 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 300 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 129 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 126 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 85 replaced by X Selenocysteine (U) at position 74 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 264 replaced by X Selenocysteine (U) at position 282 replaced by X Selenocysteine (U) at position 323 replaced by X Selenocysteine (U) at position 335 replaced by X Selenocysteine (U) at position 357 replaced by X Selenocysteine (U) at position 371 replaced by X Selenocysteine (U) at position 373 replaced by X Selenocysteine (U) at position 380 replaced by X Selenocysteine (U) at position 382 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 121 replaced by X Selenocysteine (U) at position 120 replaced by X Selenocysteine (U) at position 20 replaced by X Selenocysteine (U) at position 88 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 18 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 48 replaced by X Selenocysteine (U) at position 48 replaced by X Selenocysteine (U) at position 41 replaced by X Selenocysteine (U) at position 133 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 122 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 129 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 140 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 20 replaced by X Selenocysteine (U) at position 88 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 126 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 48 replaced by X Selenocysteine (U) at position 48 replaced by X Selenocysteine (U) at position 41 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 204 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 65 replaced by X Selenocysteine (U) at position 132 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 129 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 132 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 95 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 121 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 133 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 200 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 192 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 130 replaced by X Selenocysteine (U) at position 263 replaced by X Selenocysteine (U) at position 130 replaced by X Selenocysteine (U) at position 263 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 25 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 264 replaced by X Selenocysteine (U) at position 282 replaced by X Selenocysteine (U) at position 323 replaced by X Selenocysteine (U) at position 335 replaced by X Selenocysteine (U) at position 357 replaced by X Selenocysteine (U) at position 371 replaced by X Selenocysteine (U) at position 373 replaced by X Selenocysteine (U) at position 380 replaced by X Selenocysteine (U) at position 382 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 264 replaced by X Selenocysteine (U) at position 282 replaced by X Selenocysteine (U) at position 323 replaced by X Selenocysteine (U) at position 335 replaced by X Selenocysteine (U) at position 357 replaced by X Selenocysteine (U) at position 371 replaced by X Selenocysteine (U) at position 373 replaced by X Selenocysteine (U) at position 380 replaced by X Selenocysteine (U) at position 382 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 18 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 25 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 19 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 7 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 21 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 129 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 134 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 48 replaced by X Selenocysteine (U) at position 41 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 18 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 25 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 19 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 21 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 192 replaced by X Selenocysteine (U) at position 187 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 188 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 188 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 648 replaced by X Selenocysteine (U) at position 612 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 126 replaced by X Selenocysteine (U) at position 126 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 126 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 85 replaced by X Selenocysteine (U) at position 74 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 187 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 144 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 92 replaced by X Selenocysteine (U) at position 92 replaced by X Selenocysteine (U) at position 204 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 48 replaced by X Selenocysteine (U) at position 48 replaced by X Selenocysteine (U) at position 41 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 300 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 612 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 494 replaced by X Selenocysteine (U) at position 648 replaced by X Selenocysteine (U) at position 612 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 25 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 19 replaced by X Selenocysteine (U) at position 7 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 20 replaced by X Selenocysteine (U) at position 88 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 667 replaced by X Selenocysteine (U) at position 665 replaced by X Selenocysteine (U) at position 126 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 129 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 121 replaced by X Selenocysteine (U) at position 134 replaced by X Selenocysteine (U) at position 140 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 259 replaced by X Selenocysteine (U) at position 277 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 366 replaced by X Selenocysteine (U) at position 368 replaced by X Selenocysteine (U) at position 375 replaced by X Selenocysteine (U) at position 377 replaced by X Selenocysteine (U) at position 65 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 612 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 74 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 187 replaced by X Selenocysteine (U) at position 188 replaced by X Selenocysteine (U) at position 430 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 134 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 48 replaced by X Selenocysteine (U) at position 48 replaced by X Selenocysteine (U) at position 41 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 259 replaced by X Selenocysteine (U) at position 277 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 366 replaced by X Selenocysteine (U) at position 368 replaced by X Selenocysteine (U) at position 375 replaced by X Selenocysteine (U) at position 377 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 92 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 122 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 430 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 204 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 130 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 152 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 300 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 128 replaced by X Selenocysteine (U) at position 261 replaced by X Selenocysteine (U) at position 41 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 667 replaced by X Selenocysteine (U) at position 665 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 44 replaced by X Selenocysteine (U) at position 44 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 121 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 200 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 648 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 204 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 18 replaced by X Selenocysteine (U) at position 25 replaced by X Selenocysteine (U) at position 19 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 7 replaced by X Selenocysteine (U) at position 21 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 92 replaced by X Selenocysteine (U) at position 92 replaced by X Selenocysteine (U) at position 92 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 18 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 25 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 21 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 130 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 132 replaced by X Selenocysteine (U) at position 265 replaced by X Selenocysteine (U) at position 124 replaced by X Selenocysteine (U) at position 128 replaced by X Selenocysteine (U) at position 261 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 430 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 127 replaced by X Selenocysteine (U) at position 462 replaced by X Selenocysteine (U) at position 133 replaced by X Selenocysteine (U) at position 266 replaced by X Selenocysteine (U) at position 133 replaced by X Selenocysteine (U) at position 266 replaced by X Selenocysteine (U) at position 133 replaced by X Selenocysteine (U) at position 266 replaced by X Selenocysteine (U) at position 121 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 140 replaced by X Selenocysteine (U) at position 126 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 21 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 525 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 133 replaced by X Selenocysteine (U) at position 510 replaced by X Selenocysteine (U) at position 523 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 300 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 18 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 204 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 193 replaced by X Selenocysteine (U) at position 123 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 75 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 43 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 84 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 192 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 300 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 140 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 43 replaced by X Selenocysteine (U) at position 109 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 259 replaced by X Selenocysteine (U) at position 277 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 366 replaced by X Selenocysteine (U) at position 368 replaced by X Selenocysteine (U) at position 375 replaced by X Selenocysteine (U) at position 377 replaced by X Selenocysteine (U) at position 18 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 15 replaced by X Selenocysteine (U) at position 25 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 19 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 7 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 273 replaced by X
!blastx
BLAST query/options error: Either a BLAST database or subject sequence(s) must be specified Please refer to the BLAST+ user manual.
!tail /Volumes/web/scaphapoda/Grace/Transcriptomes/M_donacium_fasta.fa
ATTAGTAGAAGGAGAATATAGATCTTTAATCGAGAAATTGGTTGAGCTAAGGTAAGTGTT CTAAATGAAATATGTTTTTTAAGAGT >GQ18NFG04JB0FJ TCTTCGCGATGTTTATCTTCTTTAGTATTAAGTCATAAGCCTGTTTTTTTTGATCGTTGG ATTTGTAGAACTAGGCATAAAGATATTGGTACGTGGTATTTTGTGTTTTCTTATTGAGCA GGACTAGTAGGAACCGGATTTAGTTTAATTATTCGAATAGAATTAGCTATACCGGGGGAA GGAATGTTGGATGGCCAACTATATAACTTAGTTGTTACTGCTCATGCACTGGTTATGATT TTCTTTTTAGTTATGCCTATAATGATAGGGGGTTTTGGGAATTGGTTAGTGCCTTTGATG TTAAAAGTTCCAGATATAAATTTCCTCGAATGAATAATATTAGGTTCTGGTCTTCTTCCG GTTTCTATGCTTTTATTATTAGCTTCTGTCTTACGTTGAGAGAGGTGCGGG
!fgrep -c ">" /Volumes/web/scaphapoda/Grace/Transcriptomes/M_donacium_fasta.fa
180159
!tail /Volumes/web/scaphapoda/Grace/mesodesma_blastx_uniprot_hummingbird.tab
GQ18NFG04IOU8K sp|O60309|L37A3_HUMAN 45.16 31 15 1 35 121 914 944 1.4 29.6 GQ18NFG04IEHFX sp|Q4L6C4|ODO1_STAHJ 42.59 54 27 2 137 292 871 922 0.014 39.3 GQ18NFG04JDC7I sp|Q1HPK6|EF2_BOMMO 78.12 32 6 1 35 130 769 799 2e-08 53.9 GQ18NFG04JGO84 sp|P38675|MET7_NEUCR 30.14 73 45 2 306 106 322 394 0.72 32.3 GQ18NFG04I80XR sp|Q9P5N0|ABC3_SCHPO 37.50 56 33 2 514 347 801 854 0.79 33.9 GQ18NFG04IGKP6 sp|A2VDL4|SATT_BOVIN 37.01 127 69 3 16 393 316 432 2e-16 79.3 GQ18NFG04IFSJV sp|Q9UUE6|SYKC_SCHPO 73.08 26 7 0 347 424 300 325 9e-05 44.7 GQ18NFG04JB5BI sp|Q8BGD6|S38A9_MOUSE 38.24 34 20 1 5 106 480 512 6.2 28.1 GQ18NFG04JZW3W sp|Q00215|ACTC_STYPL 100.00 44 0 0 3 134 249 292 3e-26 102 GQ18NFG04JB0FJ sp|P50656|COX1_ANAPL 60.64 94 37 0 43 324 2 95 2e-34 121
time !wc -l /Volumes/web/scaphapoda/Grace/mesodesma_blastx_uniprot_hummingbird.tab
123986 /Volumes/web/scaphapoda/Grace/mesodesma_blastx_uniprot_hummingbird.tab CPU times: user 1.89 ms, sys: 5.74 ms, total: 7.62 ms Wall time: 134 ms
#finished!!
SELECT * FROM [graceac9@washington.edu].[mesodesma_blastx_uniprot_hummingbird.tab]mesodesma
left join
[samwhite@washington.edu].[UniprotProtNamesReviewed_yes20130610]sp
on
mesodesma.Column2=sp.SPID
!head /Volumes/web/scaphapoda/Grace/meodesma_blastx_uniprot_hummingbirdSPID.tab
#translate pipes to tabs
!tr '|' "\t" </Volumes/web/scaphapoda/Grace/meodesma_blastx_uniprot_hummingbirdSPID.tab> /Volumes/web/scaphapoda/Grace/meodesma_blastx_uniprot_hummingbirdSPID2.tab
!head /Volumes/web/scaphapoda/Grace/meodesma_blastx_uniprot_hummingbirdSPID2.tab
#translate commas to tabs
!tr ',' "\t" </Volumes/web/scaphapoda/Grace/meodesma_blastx_uniprot_hummingbirdSPID2.tab> /Volumes/web/scaphapoda/Grace/meodesma_blastx_uniprot_hummingbirdSPID3.tab
!head /Volumes/web/scaphapoda/Grace/meodesma_blastx_uniprot_hummingbirdSPID3.tab
#run in SQL share against SPID and GO Numbers and GO_to_GOslim
SELECT Column1, term, GOSlim_bin, aspect FROM [graceac9@washington.edu].[meodesma_blastx_uniprot_hummingbirdSPID3.tab]mesodesma
left join
[sr320@washington.edu].[SPID and GO Numbers]go
on
mesodesma.Column3=go.SPID
left join
[sr320@washington.edu].[GO_to_GOslim]slim
on
go.GOID=slim.GO_id
where aspect like 'P'
```
#"where aspect like 'P'" narrows information down to proteins that are involved in biological processes
#"Column1, term, GOSlim_bin, aspect" select specific columns of information
!head /Volumes/web/scaphapoda/Grace/mesodesma_blastx_uniprot_hummingbird_GOSlimterms.tab
#to get unique terms
!awk '{print $4}' /Volumes/web/scaphapoda/Grace/mesodesma_blastx_uniprot_hummingbird_GOSlimterms.tab | sort | uniq
1""",protein 2-methylcitrate 3'-end 3-kinase 4-hydroxy-L-proline,protein 5'-ETS 5-hydroxy-L-lysine,protein 5-monooxygenase A A,other A2 ADP-ribosylation,protein ARF ATPase B B1,other BMP C CD4-positive, CD8-positive, CREB Cdc42 CoA-linked""",other D D,other DNA DNA-dependent""",RNA E E,other ER ERK1 F FasL G-protein G0 G2/M GTP GTPase Golgi Gram-negative Gram-positive H3-K36 H3-K4 H3-K9 I I,cell I-kappaB II II,cell ITS1 IV IgG JAK-STAT JNK JUN MAP MAPK MAPKKK MHC N-linked NADH NF-kappaB NF-kappaB,signal NFAT NK Notch O-linked R7 RNA RNA,other RNA-mediated""",other Rab Rac Ran Rap Ras Rho S SMAD STAT STAT3 Schwann Stat1 Stat3 Stat5 T T-helper TOR Toll UV,other V(D)J Wnt a abscisic acetylation,cell acetylation,protein acetylcholine acid acid,other acquired actin action activated activation activation, activation,other activation,stress activation-induced active activin activity activity,cell-cell activity,other activity,protein activity,signal acute adaptive adaxial/abaxial addition,RNA adenine,DNA adenylate adhesion adhesion,cell after agglutination,stress aggregate aldosterone alpha alpha-beta amino amplification,DNA amplification,cell anaphase-promoting anchor and angiogenesis,developmental anterior/posterior antibacterial antifungal antigen antigenic antimicrobial apical apoptosis,cell appetite,other arborization architecture, arterial assembly assembly,DNA assembly,RNA assembly,cell assembly,developmental assembly,signal assembly,stress astrocyte asymmetric asymmetrical-dimethyl at attachment auto-ADP-ribosylation,protein autophagic autophagy,other autophosphorylation,protein axis, axon axon,cell axon,developmental axonogenesis,cell axonogenesis,developmental bacterium, bacterium,other bacterium,stress balance,other band barrier,developmental base based beat behavior,other beta between bile binding,other biogenesis,other biological biosynthetic bipolar bitter blastoderm blood body bone boundary,other branch""",other branching break bud bundle burst,other by c cAMP cAMP-mediated cGMP cGMP-mediated calcidiol calcium calcium-mediated calcium-release camera-type carbamoylation,protein carbohydrate cardiac cardioblast cardiomyocyte cascade,signal cascade,stress caspase catabolic catalytic catecholamine cation cell cell,cell cell,other cell-cell cell-matrix cell-substrate cellular cellulose center central centriole centromere,RNA centrosome centrosome,cell chain,other channel checkpoint,cell checkpoint,signal checkpoint,stress chelation chemical chemokine chemokine-mediated chemotaxis,other chitin chitin-containing chloroplast cholesterol chondrocyte chondroitin chromatid chromatin chromosomal chromosome chromosome,other chronic circadian class clearance,cell clock clock,other clustering,cell clustering,developmental coagulation,other coagulation,stress cocaine,other cohesion, cohesion,cell cold,stress collagen collateral commitment,cell commitment,developmental commitment,other complement complex component compound compound,other compound,stress congression,cell conjugation contact,other containing contraction,other cortical coupled crystal cuticle cuticle""",other cuticulin-based cyclase cycle cycle, cycle,cell cyclic cyclic-nucleotide cyclin-dependent cyst cytochrome cytokine cytokine-mediated cytokinesis,other cytoplasmic cytosine cytoskeleton cytotoxic damage de-ADP-ribosylation,protein deacetylation,cell deacetylation,protein defense defenses demethylation,protein dendrite dendritic density density,cell deoxyribonuclease dependent dephosphorylation,protein depolarization,other depolymerization,cell depolymerization,protein depression,cell-cell deprivation,stress derivative desumoylation,protein detection determination,developmental determination,other deubiquitination,cell deubiquitination,protein development,cell development,developmental development,other development,stress developmental diameter, diameter,other differentiation differentiation,developmental differentiation,other differentiation,stress dioxide,other dipeptide,other disassembly,cell disc disc-derived discrimination""",other distribution,cell division,cell division,other docking,other domain dopamine dorsal/ventral double-strand dsRNA,other duplex duplication duplication,cell during ectodomain edge editing,RNA egress, elastin electron elongation elongation,RNA elongation,developmental elongation,protein embryonic embryonic""",cell embryonic""",developmental encompassing end endocytosis,cell endodermal endonucleolytic endonucleolytic""",DNA endopeptidase endoplasmic endothelial ends,DNA epidermal epinephrine epithelial epithelium,developmental epithelium,other erythrocyte estrogen ethanol,other ether,other excess,other exclusion,developmental exit expansion,developmental export expression, expression,other extension extension,cell extension,developmental extracellular extravasation,other eye factor family fast-twitch fat fate fatty female fever,stress fiber fibrinolysis,stress fibroblast fidelity,protein filament filament-based filamentous filopodium fixation flocculation,other flower fluence fluid foam focal folding folding,protein follicle follicle,developmental follicle-stimulating for force forebrain,cell forebrain,developmental formation formation""",cell formation,DNA formation,cell formation,developmental formation,other formation,protein forming from fructose function, fungus, fungus,other fungus,stress furrow fusion fusion, fusion,cell fusion,other galactosylation,protein gametogenesis,DNA gamma-aminobutyric gamma-delta gap gaseous gastric gastrulation gene gene-specific generate genitalia genome germ germ-line,developmental germarium-derived germinal germination,developmental gland glial gliogenesis,developmental glomerular glucagon glucocorticoid glucokinase gluconeogenesis,other glucose glucosylceramide glutamate glutamate-cysteine glutathionylation,protein glycine glycogen glycolysis,other glycoprotein glycosylation glycosylation,protein granule granulocyte growth growth,developmental growth,other guanylate guidance,cell guidance,developmental hair heart heat,stress helicase hemocyte hemoglobin hemopoiesis,developmental hepatocyte heterochromatin heterochronic""",other heterodimerization heterotypic hh high-density hindbrain,cell hindbrain,developmental histogenesis,developmental histone homeostasis,other homodimerization homotypic hormone host humoral hydrogen hydrolase hydroperoxide,stress hyperactivation hypoactivation hypusine,protein identity, identity,developmental imaginal immature immune immunity,other immunoglobulin immunoglobulins,developmental import impulse,other in inactivity,other incision""",DNA incision""",stress incision, induction infection,other inflammatory initiation initiation,protein injury,stress innate innervation,cell innervation,developmental inositol inositol-polyphosphate insect,stress insulin insulin-like integrin integrity, intensity,other interaction interaction""",stress interaction,cell-cell interaction,developmental interferon-alpha interferon-beta interferon-gamma interferon-gamma-mediated interleukin-1 interleukin-10 interleukin-12 interleukin-17 interleukin-18 interleukin-2 interleukin-23 interleukin-3 interleukin-4 interleukin-5 interleukin-6 interleukin-8 internalization,cell internalization,other internalization,signal interneuron intestinal into intracellular involved ion ion,other ion-dependent iron island,DNA isotype jasmonic joint juvenile keratinocyte killer killing kinase kinase/NF-kappaB kinetochore,other lamellipodium lamellocyte late lateral layer length, leukocyte levels levels,cell-cell levels,other life ligase ligation""",DNA ligation""",stress light light,other linked lipase lipid lipidation,protein lipopolysaccharide-mediated lipoprotein loading localization,cell localization,developmental localization,other location location,other locomotion,other locomotory long-term low-density lung lyase lymphocyte mRNA macroautophagy,other macroautophagy,stress macromolecule macrophage magnesium maintenance maintenance,DNA maintenance,cell maintenance,other male mammary mannosylation,protein margin mast mating-type mature mechanical mediated mediator megakaryocyte meiosis,cell meiotic melanocyte membrane membrane,cell memory meristem mesenchymal mesodermal metabolic metabolites metallo-sulfur metalloenzyme metaphase/anaphase methylation,DNA methylation,RNA methylation,cell methylation,protein miRNA, miRNA,other microtubule microtubules midbrain,cell midbrain,developmental migration,developmental migration,other mineralization,developmental mitochondria,cell mitochondrial mitochondrion,cell mitochondrion,other mitosis,cell mitotic modification modification,RNA modification,cell modification,protein molecular molybdenum-molybdopterin monocyte monomers,cell monomers,protein monooxygenase monoxide,other morphogenesis,cell morphogenesis,developmental morphology motility motility,other motion,other movement,other mucosal multicellular multivesicular muscle muscle,other myelination,developmental myeloid myoblast natural necrosis necrotic negative nerve neuroblast neurogenesis,developmental neurological neuromuscular neuron neuronal neurotransmitter neutrophil nicotinamide nicotine,other nitric nitric-oxide nitrogen nitrogen,other nonself norepinephrine nuclear nuclear-transcribed nucleation,cell nucleolar nucleotide nucleus nucleus, nucleus,cell nucleus,other nutrient nutrient,other odontogenesis odontogenesis,developmental of oligodendrocyte on oocyte oomycetes,stress open or organ organelle,other organism organism,other organisms,other organization organization,cell organization,cell-cell organization,developmental orientation oskar ossification,developmental osteoblast osteoclast ovulation,other oxidation,protein oxidative oxide oxidoreductase oxygen pH,other packaging,cell pain,other pain,stress pair pathway pathway""",protein pathway""",stress pathway, pathway,developmental pathway,protein pathway,signal pathway,stress pathway-restricted pattern patterning,developmental pellucida,other penile peptidase peptide peptidyl-N6-pyridoxal peptidyl-serine peptidyl-threonine peptidyl-tyrosine perception peripheral permeability,other peroxide peroxide,stress peroxisome peroxisome,cell phagocytosis, phagocytosis,cell phase phase,cell phase,other phosphatase phosphate phosphatidylinositol phosphoinositide phospholipase phospholipid phosphoprotein phosphorylation phosphorylation,other phosphorylation,protein phosphorylation,signal photomorphogenesis,developmental photoreceptor phototransduction""",other phytotoxin,other pigmentation pigmentation,developmental pinocytosis,cell plasm plasma plasminogen plasticity,cell-cell platelet platelet,cell-cell platelet,stress platelet-derived point polarity,cell polarity,developmental polarity,other polarization,cell polarization,developmental polarized pole poly-ADP-ribosylation,protein polyadenylation-dependent polyamination,protein polymerase polymerization polymerization,cell polymerization,protein polyunsaturated position,developmental positive postnatal postsynaptic posture,other potassium potential potential,other pre-autophagosomal pre-catalytic preinitiation presentation presentation, presentation,other pressure,other pressure,stress proboscis-mediated process process""",other process, process,DNA process,RNA process,cell process,cell-cell process,developmental process,other process,protein process,stress processing processing,DNA processing,RNA processing,protein processing,stress production,other programmed projection proliferation proliferation,cell proliferation,developmental promoter,RNA promoter,cell propagation,other prostaglandin prostaglandin-endoperoxidase prostate prostatic proteasomal protein protein,stress proteolysis,protein proton protozoan,stress proximal/distal pseudopodium pumping,other pupal purine pyrimidine rDNA,RNA rRNA rRNA,RNA radiation,other radical,stress radicals,other rate rate,other reactive reassembly,cell receptivity,other receptor receptor-mediated reciprocal recognition recombination,DNA recombination,cell recycling recycling,protein recycling,signal red reflex refolding,protein regulatory release release,other remodeling,cell remodeling,other repair,DNA repair,stress repeat replication replication,DNA reproduction,other resorption,other respiration,other respiratory response response,other response,stress resulting reticulum retinal retinoic rhythm,other rolling,cell rotation,other ryanodine-sensitive saliva salivary salty salvage,other sarcomere satellite saturated secreting secretion,cell secretion,cell-cell seed segregation,cell segregation,other selection,RNA selection,cell selection,developmental self semi-conservative separation separation""",other separation,cell septation septum sequestered sequestering serine/threonine serotonin shape,cell shear signal signaling signaling,signal silencing silencing,RNA silencing,cell silencing,stress silent single-species sister site size size, size,other skeletal sleep/wake small smell,other smooth smoothened sodium soma""",developmental sorocarp sound,other specification, specification,cell specification,developmental specification,other specificity spinal spindle spliceosome splicing, splicing,RNA sporulation spreading,cell sprouting stability,RNA stability,protein stalk starvation,stress state,other stem stereocilium steroid stimulus stimulus,other storage,other stress stress,stress stress-activated striated structural structure substance,other substitution succinate succinate,other sucrose sulfate sulfation,protein sulfide:quinone sulfur survival sweet switching switching, symmetrical-dimethyl symmetry,developmental synaptic synaptogenesis,cell synaptogenesis,cell-cell synaptogenesis,developmental synthase synthesis,DNA synthesis,cell synthesis,stress synthesized system system,signal systemic tail targeting taste,other telomerase telomerase,DNA telomerase,cell telomere telomere,RNA telomere,other terminal termination,RNA termination,cell termination,protein the thiamin thiolation,RNA through thymidylate thymocyte tip tissue tissues to toll-like tooth tooth,developmental towards tracheal transcription transcription, transcription,RNA transcription,cell transcriptional transduction,signal transesterification transferase transforming transition transition,cell transition,developmental translation translation,protein translational translocation,signal transmission transmission, transmission,cell-cell transport transport, transporter transposition, transposition,other tri-snRNP,RNA tri-snRNP,cell triglyceride trimethyl-H3-K4-specific""",cell trimethyl-H3-K4-specific""",protein tube tubule tumor type tyrosine ubiquinol ubiquitin-dependent ubiquitin-protein ubiquitination,cell ubiquitination,protein umami unfolded unsaturated unwinding,RNA upon uptake,cell-cell ureteric using utilization,other vacuole vascular vasoconstriction,other vasodilation,other vein veined very-low-density vesicle vesicle-mediated vessel vessels,developmental via viral virus,other virus,stress vitamin volume vulval wall water water,other with within wound zinc
#grep all terms pertaining to reproduction/sex-determination/etc
!egrep -wi --color 'aldosterone|female|gametogenesis|genitalia|germ|germ-line|germarium-derived|germinal|germination|hormone|juvenile|male|mating-type|oocyte|ovulation|penile|postnatal|prostate|prostatic|reproduction|vulval' /Volumes/web/scaphapoda/Grace/mesodesma_blastx_uniprot_hummingbird_GOSlimterms.tab
#want to make chart separating aspects of reproduction
#not sure how to do that
from pandas import *
jslim = read_table("/Volumes/web/scaphapoda/Grace/mesodesma_blastx_uniprot_hummingbird_GOSlimterms.tab", # name of the data file
#sep=",", # what character separates each column?
na_values=["", " "]) # what values should be considered "blank" values?
jslim.groupby('GOSlim_bin').Column1.count().plot(kind='bar')
--------------------------------------------------------------------------- KeyError Traceback (most recent call last) <ipython-input-42-e63d7d4fa73a> in <module>() ----> 1 jslim.groupby('GOSlim_bin').Column1.count().plot(kind='bar') /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/generic.pyc in groupby(self, by, axis, level, as_index, sort, group_keys, squeeze) 2670 axis = self._get_axis_number(axis) 2671 return groupby(self, by, axis=axis, level=level, as_index=as_index, -> 2672 sort=sort, group_keys=group_keys, squeeze=squeeze) 2673 2674 def asfreq(self, freq, method=None, how=None, normalize=False): /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/groupby.pyc in groupby(obj, by, **kwds) 787 raise TypeError('invalid type: %s' % type(obj)) 788 --> 789 return klass(obj, by, **kwds) 790 791 /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/groupby.pyc in __init__(self, obj, keys, axis, level, grouper, exclusions, selection, as_index, sort, group_keys, squeeze) 236 if grouper is None: 237 grouper, exclusions = _get_grouper(obj, keys, axis=axis, --> 238 level=level, sort=sort) 239 240 self.grouper = grouper /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/groupby.pyc in _get_grouper(obj, key, axis, level, sort) 1610 exclusions.append(gpr) 1611 name = gpr -> 1612 gpr = obj[gpr] 1613 1614 if isinstance(gpr, Categorical) and len(gpr) != len(obj): /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/frame.pyc in __getitem__(self, key) 1656 return self._getitem_multilevel(key) 1657 else: -> 1658 return self._getitem_column(key) 1659 1660 def _getitem_column(self, key): /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/frame.pyc in _getitem_column(self, key) 1663 # get column 1664 if self.columns.is_unique: -> 1665 return self._get_item_cache(key) 1666 1667 # duplicate columns & possible reduce dimensionaility /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/generic.pyc in _get_item_cache(self, item) 1003 res = cache.get(item) 1004 if res is None: -> 1005 values = self._data.get(item) 1006 res = self._box_item_values(item, values) 1007 cache[item] = res /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/internals.pyc in get(self, item) 2871 return self.get_for_nan_indexer(indexer) 2872 -> 2873 _, block = self._find_block(item) 2874 return block.get(item) 2875 else: /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/internals.pyc in _find_block(self, item) 3183 3184 def _find_block(self, item): -> 3185 self._check_have(item) 3186 for i, block in enumerate(self.blocks): 3187 if item in block: /usr/local/bioinformatics/anaconda/lib/python2.7/site-packages/pandas/core/internals.pyc in _check_have(self, item) 3190 def _check_have(self, item): 3191 if item not in self.items: -> 3192 raise KeyError('no item named %s' % com.pprint_thing(item)) 3193 3194 def reindex_axis(self, new_axis, indexer=None, method=None, axis=0, KeyError: u'no item named GOSlim_bin'