pwd
u'/Users/srlab'
!curl -O http://eagle.fish.washington.edu/cnidarian/Ruphibase.fa
% Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 17.8M 100 17.8M 0 0 17.2M 0 0:00:01 0:00:01 --:--:-- 17.2M
ls
Ruphibase.fa
!head Ruphibase.fa
>ruditapes2_lrc7040 ATTCAAATCTCTAACACTGATTCATACATGTAATAACTTGGCATACTATACATTATCAAC ATGTACTGTTACTTTCCTGTAATTGTTCAAAATATCTCTGGAATATTTTACACTTTATCT GTGGTTTTTTACAGTTTTTTTTTAATTGAAATAGTGATAACTTTGATTGAACATTCTTTT ATGTTTTAGCATCAAGATCTTCAAACTTGTAATACACACAATATCAATAACAAAATGTGA CAGTTTTATTTTCATTCATCATACACATCTTCCTTATCACATACATACTGACATAGATTC TGGTGTCATAAGACGGTCTGCATCTTGGTCAGGTATTTCAAATCTAAATTCATCTTCCAT TGCCATGATAACTTCTACAACATCTAAACTGTCCAATCCTAAATCATTCATAAAGTGTGA AGTCAATGACAGCTTTTCGGGATCAACTTTATCATAAAGTTGCAAAACGAGAATGACTCT TTCTTTAACATGAGATATTGTGAGAGCTGGCTTCTGACCATAATATCGAGGGTTTTGAAT
!fgrep -c ">" Ruphibase.fa
32606
wd="/Volumes/web/scaphapoda/Grace/Transcriptomes/rphilippinarum"
dircode="rp"
cd {wd}
/Volumes/web/scaphapoda/Grace/Transcriptomes/rphilippinarum
!blastx \
-query Ruphibase.fa \
-db /Volumes/Data/blast_db/uniprot_sprot \
-max_target_seqs 1 \
-max_hsps 1 \
-outfmt 6 \
-num_threads 8 \
-out blast_sprot.tab
Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 85 replaced by X Selenocysteine (U) at position 74 replaced by X Selenocysteine (U) at position 612 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 140 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 349 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 75 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 123 replaced by X Selenocysteine (U) at position 60 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 63 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 85 replaced by X Selenocysteine (U) at position 74 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 106 replaced by X Selenocysteine (U) at position 192 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 121 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 65 replaced by X Selenocysteine (U) at position 612 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 648 replaced by X Selenocysteine (U) at position 121 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 612 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 16 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 612 replaced by X Selenocysteine (U) at position 106 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 37 replaced by X Selenocysteine (U) at position 44 replaced by X Selenocysteine (U) at position 44 replaced by X Selenocysteine (U) at position 38 replaced by X Selenocysteine (U) at position 192 replaced by X Selenocysteine (U) at position 187 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 188 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 297 replaced by X Selenocysteine (U) at position 307 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 363 replaced by X Selenocysteine (U) at position 365 replaced by X Selenocysteine (U) at position 372 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 390 replaced by X Selenocysteine (U) at position 397 replaced by X Selenocysteine (U) at position 399 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 124 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 37 replaced by X Selenocysteine (U) at position 20 replaced by X Selenocysteine (U) at position 88 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 666 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 121 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 264 replaced by X Selenocysteine (U) at position 282 replaced by X Selenocysteine (U) at position 323 replaced by X Selenocysteine (U) at position 335 replaced by X Selenocysteine (U) at position 357 replaced by X Selenocysteine (U) at position 371 replaced by X Selenocysteine (U) at position 373 replaced by X Selenocysteine (U) at position 380 replaced by X Selenocysteine (U) at position 382 replaced by X Selenocysteine (U) at position 85 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 131 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 642 replaced by X Selenocysteine (U) at position 651 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 200 replaced by X Selenocysteine (U) at position 204 replaced by X Selenocysteine (U) at position 95 replaced by X Selenocysteine (U) at position 95 replaced by X Selenocysteine (U) at position 196 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 613 replaced by X Selenocysteine (U) at position 192 replaced by X Selenocysteine (U) at position 187 replaced by X Selenocysteine (U) at position 188 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 612 replaced by X Selenocysteine (U) at position 498 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 64 replaced by X Selenocysteine (U) at position 188 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 264 replaced by X Selenocysteine (U) at position 282 replaced by X Selenocysteine (U) at position 323 replaced by X Selenocysteine (U) at position 335 replaced by X Selenocysteine (U) at position 357 replaced by X Selenocysteine (U) at position 371 replaced by X Selenocysteine (U) at position 373 replaced by X Selenocysteine (U) at position 380 replaced by X Selenocysteine (U) at position 382 replaced by X Selenocysteine (U) at position 388 replaced by X Selenocysteine (U) at position 189 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 13 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 300 replaced by X Selenocysteine (U) at position 318 replaced by X Selenocysteine (U) at position 330 replaced by X Selenocysteine (U) at position 345 replaced by X Selenocysteine (U) at position 352 replaced by X Selenocysteine (U) at position 367 replaced by X Selenocysteine (U) at position 369 replaced by X Selenocysteine (U) at position 376 replaced by X Selenocysteine (U) at position 378 replaced by X Selenocysteine (U) at position 59 replaced by X Selenocysteine (U) at position 267 replaced by X Selenocysteine (U) at position 273 replaced by X Selenocysteine (U) at position 279 replaced by X Selenocysteine (U) at position 290 replaced by X Selenocysteine (U) at position 292 replaced by X Selenocysteine (U) at position 294 replaced by X Selenocysteine (U) at position 310 replaced by X Selenocysteine (U) at position 320 replaced by X Selenocysteine (U) at position 322 replaced by X Selenocysteine (U) at position 336 replaced by X Selenocysteine (U) at position 338 replaced by X Selenocysteine (U) at position 346 replaced by X Selenocysteine (U) at position 353 replaced by X Selenocysteine (U) at position 355 replaced by X Selenocysteine (U) at position 362 replaced by X Selenocysteine (U) at position 364 replaced by X Selenocysteine (U) at position 24 replaced by X Selenocysteine (U) at position 690 replaced by X Selenocysteine (U) at position 17 replaced by X Selenocysteine (U) at position 387 replaced by X Selenocysteine (U) at position 637 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 350 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 127 replaced by X Selenocysteine (U) at position 462 replaced by X Selenocysteine (U) at position 37 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 49 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 52 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 46 replaced by X Selenocysteine (U) at position 47 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 40 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 73 replaced by X Selenocysteine (U) at position 204 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 93 replaced by X Selenocysteine (U) at position 92 replaced by X Selenocysteine (U) at position 197 replaced by X Selenocysteine (U) at position 131 replaced by X
!wc -l blast_sprot.tab
19506 blast_sprot.tab
!tr '|' "\t" <blast_sprot.tab> blast_sprot_sql.tab
!head blast_sprot_sql.tab
ruditapes2_lrc7040 sp P52505 ACPM_BOVIN 65.82 79 27 0 528 292 66 144 8e-30 114 ruditapes2_c3688 sp P02637 SCP_MIZYE 33.03 109 71 2 95 418 1 108 3e-12 65.1 ruditapes2_c1400 sp Q86UP6 CUZD1_HUMAN 24.44 135 101 1 76 480 392 525 3e-10 63.5 ruditapes2_c3682 sp Q9D2R8 RT33_MOUSE 50.00 88 43 1 557 294 5 91 9e-19 83.6 ruditapes2_c4432 sp Q8VEM8 MPCP_MOUSE 81.82 121 22 0 62 424 237 357 7e-55 184 ruditapes2_c3421 sp O58530 RGYR_PYRHO 40.91 44 20 2 81 212 1339 1376 0.15 34.7 ruditapes2_c3350 sp Q4KLV7 F50AB_XENLA 31.03 58 39 1 888 715 258 314 3.8 32.7 ruditapes2_c3356 sp Q25379 ACT3_LYTPI 83.72 86 7 2 106 351 90 172 2e-40 144 ruditapes2_c3354 sp Q9BW30 TPPP3_HUMAN 41.40 157 74 5 157 621 30 170 5e-18 84.3 ruditapes2_c3427 sp B7IF15 DAPH_THEAB 33.33 66 43 1 476 670 38 103 7.8 31.2
!python /Applications/sqlshare-pythonclient-master/tools/singleupload.py \
-d {dircode}_uniprot \
blast_sprot_sql.tab
processing chunk line 0 to 19506 (0.00798296928406 s elapsed) pushing blast_sprot_sql.tab... parsing 88DEA829... finished rp_uniprot
!python /Applications/sqlshare-pythonclient-master/tools/fetchdata.py \
-s "SELECT Column1, term, GOSlim_bin, aspect, ProteinName FROM [graceac9@washington.edu].[rp_uniprot]rp left join [samwhite@washington.edu].[UniprotProtNamesReviewed_yes20130610]sp on rp.Column3=sp.SPID left join [sr320@washington.edu].[SPID and GO Numbers]go on rp.Column3=go.SPID left join [sr320@washington.edu].[GO_to_GOslim]slim on go.GOID=slim.GO_id where aspect like 'P'" \
-f tsv \
-o {dircode}_descriptions.txt
!head {dircode}_descriptions.txt
pylab inline
File "<ipython-input-36-b794e5809f34>", line 1 pylab inline ^ SyntaxError: invalid syntax
from pandas import *
gs = read_table('rp_descriptions.txt')
gs.groupby('GOSlim_bin').Column1.count().plot(kind='barh', color=list('y'))
<matplotlib.axes.AxesSubplot at 0x10ece1ad0>
!egrep --color "male|female|genitalia|gonad|ovarian|reproduction|estrogen|testosterone|gametogenesis|germination|ovulation|penile|prostate|vulval" <{dircode}_descriptions.txt> {dircode}_reprot.txt
!head -2 {dircode}_reprot.txt
#counting list of associated GO terms
!cut -f 2 {dircode}_reprot.txt | sort | uniq -c
2 "dorsal/ventral axis specification, ovarian follicular epithelium" 2 "male courtship behavior, veined wing generated song production" 2 "negative regulation of transcription, DNA-dependent" 1 "nuclear-transcribed mRNA catabolic process, nonsense-mediated decay" 1 "regulation of transcription, DNA-dependent" 1 "transcription, DNA-dependent" 1 3'-phosphoadenosine 5'-phosphosulfate metabolic process 7 DNA methylation during gametogenesis 1 DNA recombination 2 DNA repair 2 GTP catabolic process 1 apoptosis 1 biological_process 1 camalexin biosynthetic process 2 carbohydrate metabolic process 1 cell cycle 2 cellulose catabolic process 1 development of secondary female sexual characteristics 1 development of secondary male sexual characteristics 1 embryonic genitalia morphogenesis 1 embryonic process involved in female pregnancy 5 estrogen biosynthetic process 15 estrogen metabolic process 1 external genitalia morphogenesis 1 female analia development 5 female gamete generation 1 female genitalia development 1 female genitalia morphogenesis 1 female germ-line sex determination 5 female germ-line stem cell division 4 female gonad development 4 female meiosis chromosome segregation 15 female pregnancy 1 female sex determination 1 generation of ovulation cycle rhythm 4 germarium-derived female germ-line cyst encapsulation 21 gonad development 2 gonad morphogenesis 4 gonadal mesoderm development 36 hermaphrodite genitalia development 1 imaginal disc-derived male genitalia development 2 imaginal disc-derived male genitalia morphogenesis 6 inter-male aggressive behavior 1 intra-Golgi vesicle-mediated transport 1 intracellular protein transport 3 ion transport 1 iron ion homeostasis 1 iron ion transport 1 male analia development 4 male courtship behavior 4 male genitalia development 1 male genitalia morphogenesis 1 male germ-line stem cell division 15 male gonad development 1 male mating behavior 7 male meiosis 1 male meiosis I 1 male meiosis chromosome segregation 1 male meiosis cytokinesis 2 male sex determination 1 megagametogenesis 1 membrane fusion 6 mesenchymal-epithelial cell signaling involved in prostate gland development 2 metabolic process 1 microgametogenesis 4 mitosis 2 mitotic cell cycle 1 multicellular organism reproduction 1 multicellular organismal development 1 negative regulation of cell growth 1 negative regulation of cell proliferation 1 negative regulation of estrogen receptor signaling pathway 2 negative regulation of mammary gland epithelial cell proliferation 1 negative regulation of ovulation 1 negative regulation of phosphatase activity 1 negative regulation of viral reproduction 10 negative regulation of vulval development 2 ovarian follicle atresia 6 ovarian follicle cell development 3 ovarian follicle cell migration 2 ovarian follicle cell stalk formation 12 ovarian follicle development 2 ovarian fusome organization 1 ovarian nurse cell to oocyte transport 8 ovarian ring canal formation 1 ovulation 3 ovulation cycle 1 ovulation from ovarian follicle 1 oxidation reduction 1 phosphorylation 3 pollen germination 2 polysaccharide catabolic process 2 positive regulation of estrogen receptor signaling pathway 1 positive regulation of seed germination 1 positive regulation of vulval development 1 prostate gland development 1 protein complex assembly 1 protein stabilization 1 protein transport 1 regulation of estrogen receptor signaling pathway 1 regulation of female receptivity 1 regulation of seed germination 103 reproduction 1 response to DNA damage stimulus 22 response to estrogen stimulus 1 response to gonadotropin stimulus 1 response to hormone stimulus 5 response to testosterone stimulus 3 secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development 4 seed germination 5 sexual reproduction 2 signal transduction 3 small GTPase mediated signal transduction 2 spindle assembly involved in female meiosis 2 spindle assembly involved in female meiosis I 2 spore germination 2 sporulation resulting in formation of a cellular spore 1 steroid metabolic process 2 sulfation 1 terminal region determination 2 transmembrane transport 4 transport 1 vesicle-mediated transport 130 viral reproduction 4 vulval development 1 vulval location 1 xenobiotic metabolic process
!wc -l {dircode}_reprot.txt
617 rp_reprot.txt